attaatttcttgaccttccccttgctggaaggtttataatgggagctgtcacggatgc
The query sequence (length=58) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7c17:1 | 58 | 58 | 1.0000 | 1.0000 | 1.0000 | 1.78e-26 | |
2 | 6ldi:1 | 50 | 50 | 0.8621 | 1.0000 | 1.0000 | 4.97e-22 | |
3 | 7c17:2 | 46 | 35 | 0.6034 | 0.7609 | 1.0000 | 1.08e-13 | |
4 | 6xh8:2 | 54 | 28 | 0.4828 | 0.5185 | 1.0000 | 8.44e-10 | |
5 | 6xh7:2 | 48 | 28 | 0.4828 | 0.5833 | 1.0000 | 8.44e-10 | |
6 | 6xh7:1 | 54 | 28 | 0.4828 | 0.5185 | 1.0000 | 8.44e-10 | 6xh8:1 |