atgtgcaacagcatgatcgcggcaagctgatcgtgcaaaagtcgtgccagc
The query sequence (length=51) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8reb:T | 52 | 51 | 1.0000 | 0.9808 | 1.0000 | 1.16e-22 | |
| 2 | 8rea:T | 51 | 51 | 1.0000 | 1.0000 | 1.0000 | 1.16e-22 | |
| 3 | 8re4:T | 50 | 50 | 0.9804 | 1.0000 | 1.0000 | 4.16e-22 | |
| 4 | 8rec:T | 51 | 51 | 0.9608 | 0.9608 | 0.9608 | 9.01e-19 | |
| 5 | 8red:T | 51 | 51 | 0.9412 | 0.9412 | 0.9412 | 1.51e-16 |
umich.edu