agattgagaccaggtctccgtttcatgagtctttcccgcacgagcgggggtg
The query sequence (length=52) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8fyd:G | 64 | 52 | 1.0000 | 0.8125 | 1.0000 | 3.31e-23 | |
2 | 8fyc:G | 57 | 52 | 1.0000 | 0.9123 | 1.0000 | 3.31e-23 | |
3 | 8fyb:G | 52 | 52 | 1.0000 | 1.0000 | 1.0000 | 3.31e-23 |