agatatatctacgtttaacagtggccttattaaatgacttctccatgatctac
The query sequence (length=53) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8ff5:N | 53 | 53 | 1.0000 | 1.0000 | 1.0000 | 9.44e-24 | |
| 2 | 8ff4:N | 85 | 53 | 1.0000 | 0.6235 | 1.0000 | 9.44e-24 | |
| 3 | 8fcu:N | 63 | 53 | 1.0000 | 0.8413 | 1.0000 | 9.44e-24 | |
| 4 | 8fcj:N | 38 | 38 | 0.7170 | 1.0000 | 1.0000 | 2.06e-15 | |
| 5 | 8rdu:3 | 98 | 40 | 0.7358 | 0.3980 | 0.9750 | 2.66e-14 | |
| 6 | 8bd5:C | 41 | 32 | 0.6038 | 0.7805 | 1.0000 | 4.46e-12 | |
| 7 | 8yha:T | 47 | 31 | 0.5849 | 0.6596 | 1.0000 | 1.60e-11 |
umich.edu