acttgacatcccacctcacgtatgctataatgtgtgcagtctgacgcgg
The query sequence (length=49) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4yln:1 | 49 | 49 | 1.0000 | 1.0000 | 1.0000 | 1.41e-21 | 4yln:4, 4yln:7 |
| 2 | 6b6h:1 | 88 | 48 | 0.9796 | 0.5455 | 1.0000 | 5.08e-21 | |
| 3 | 4ylo:1 | 49 | 49 | 0.9796 | 0.9796 | 0.9796 | 2.37e-19 | 4ylo:4, 4ylo:7, 4ylp:1, 4ylp:4, 4ylp:7 |
| 4 | 4yln:2 | 49 | 50 | 0.9184 | 0.9184 | 0.9000 | 3.08e-13 | 4yln:5, 4yln:8 |
| 5 | 5ipl:1 | 33 | 33 | 0.6735 | 1.0000 | 1.0000 | 1.11e-12 | 5ipm:1, 5ipn:1, 6utw:111 |
| 6 | 6b6h:2 | 88 | 49 | 0.8980 | 0.5000 | 0.8980 | 1.11e-12 | |
| 7 | 6utx:111 | 32 | 32 | 0.6531 | 1.0000 | 1.0000 | 3.99e-12 | 6uty:111, 6uua:111, 6uub:111 |
| 8 | 6pb4:1 | 78 | 29 | 0.5918 | 0.3718 | 1.0000 | 1.85e-10 | 6pb5:1, 6pb6:1 |
umich.edu