actccagtacgcattccacttatcactaaaagatcggaag
The query sequence (length=40) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8sfl:D | 40 | 40 | 1.0000 | 1.0000 | 1.0000 | 1.15e-16 | |
| 2 | 8sfl:C | 40 | 40 | 1.0000 | 1.0000 | 1.0000 | 1.15e-16 | |
| 3 | 8sfn:D | 34 | 34 | 0.8500 | 1.0000 | 1.0000 | 2.49e-13 | |
| 4 | 8sfn:C | 34 | 34 | 0.8500 | 1.0000 | 1.0000 | 2.49e-13 | |
| 5 | 8sfq:C | 34 | 30 | 0.7500 | 0.8824 | 1.0000 | 4.17e-11 | 8sfr:C |
| 6 | 8sfo:D | 40 | 30 | 0.7500 | 0.7500 | 1.0000 | 4.17e-11 | |
| 7 | 8sfo:C | 40 | 30 | 0.7500 | 0.7500 | 1.0000 | 4.17e-11 | |
| 8 | 8sfp:C | 36 | 28 | 0.7000 | 0.7778 | 1.0000 | 5.40e-10 |
umich.edu