Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>dna
accgtgcgtgttgactattttacctctggcggtgataatggttgcatgtactaaggaggttgtatgtc

The query sequence (length=68) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 7mkd:Q 68 68 1.0000 1.0000 1.0000 6.04e-32
2 7mkd:P 68 68 1.0000 1.0000 1.0000 6.04e-32
3 6n4c:b 94 63 0.9265 0.6702 1.0000 3.64e-29
4 6n4c:a 94 63 0.9265 0.6702 1.0000 3.64e-29
5 8to6:O 56 55 0.8088 0.9821 1.0000 1.02e-24
6 8tom:P 40 40 0.5882 1.0000 1.0000 2.22e-16
7 8tom:O 40 40 0.5882 1.0000 1.0000 2.22e-16
8 7mki:P 49 52 0.7059 0.9796 0.9231 2.87e-15
9 8toe:O 40 36 0.5294 0.9000 1.0000 3.71e-14
10 8to8:O 39 36 0.5294 0.9231 1.0000 3.71e-14
11 8to1:O 36 35 0.5147 0.9722 1.0000 1.34e-13
12 8to6:P 42 34 0.5000 0.8095 1.0000 4.80e-13
13 7mki:Q 47 52 0.6912 1.0000 0.9038 4.80e-13
14 8to1:P 34 33 0.4853 0.9706 1.0000 1.73e-12 8to8:P, 8toe:P
15 7mke:P 44 33 0.4853 0.7500 1.0000 1.73e-12

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218