aataatgtcaccctgcttgctctgttgaaagcggc
The query sequence (length=35) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6ltr:C | 35 | 35 | 1.0000 | 1.0000 | 1.0000 | 5.60e-14 | 6ltu:C |
umich.edu