BioLiP

>dna
aagggcgcctataaaagggggtggttgtgtctacttcgagccgagcagacgtgcctacggacc

The query sequence (length=63) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value
1	8was:X	63	63	1.0000	1.0000	1.0000	3.29e-29
2	8war:X	63	63	0.9841	0.9841	0.9841	5.51e-27
3	8waq:X	63	63	0.9683	0.9683	0.9683	2.56e-25
4	8wap:X	63	63	0.9524	0.9524	0.9524	4.29e-23
5	8wao:X	63	63	0.9365	0.9365	0.9365	2.00e-21
6	8wan:X	63	63	0.9206	0.9206	0.9206	3.34e-19
7	8wal:X	63	63	0.9048	0.9048	0.9048	1.55e-17
8	8was:Y	73	73	1.0000	0.8630	0.8630	2.60e-15
9	8wak:X	63	63	0.8889	0.8889	0.8889	2.60e-15
10	8war:Y	73	73	0.9841	0.8493	0.8493	4.35e-13
11	8waq:Y	73	32	0.5079	0.4384	1.0000	5.63e-12
12	8waq:Y	73	31	0.4921	0.4247	1.0000	2.02e-11
13	8wan:Y	73	32	0.5079	0.4384	1.0000	5.63e-12
14	8wan:Y	73	29	0.4603	0.3973	1.0000	2.62e-10
15	8wap:Y	73	31	0.4921	0.4247	1.0000	2.02e-11
16	8wap:Y	73	30	0.4762	0.4110	1.0000	7.28e-11
17	8wav:X	43	30	0.4762	0.6977	1.0000	7.28e-11
18	8wao:Y	73	30	0.4762	0.4110	1.0000	7.28e-11
19	8wao:Y	73	29	0.4603	0.3973	1.0000	2.62e-10
20	8wax:Y	54	29	0.4603	0.5370	1.0000	2.62e-10
21	8wax:X	43	29	0.4603	0.6744	1.0000	2.62e-10
22	8waw:Y	54	29	0.4603	0.5370	1.0000	2.62e-10
23	8waw:X	43	29	0.4603	0.6744	1.0000	2.62e-10
24	8wav:Y	54	29	0.4603	0.5370	1.0000	2.62e-10
25	8wau:Y	54	29	0.4603	0.5370	1.0000	2.62e-10
26	8wau:X	43	29	0.4603	0.6744	1.0000	2.62e-10
27	8wat:Y	54	29	0.4603	0.5370	1.0000	2.62e-10
28	8wat:X	43	29	0.4603	0.6744	1.0000	2.62e-10
29	8wal:Y	78	29	0.4603	0.3718	1.0000	2.62e-10
30	8wal:Y	78	28	0.4444	0.3590	1.0000	9.42e-10
31	8wak:Y	77	29	0.4603	0.3766	1.0000	2.62e-10
32	8way:Y	54	28	0.4444	0.5185	1.0000	9.42e-10
33	8way:X	43	28	0.4444	0.6512	1.0000	9.42e-10

[Back]