aagggcgcctataaaagggggtggttgtgaacttcatctacttcgagccgagcagacgtgcct
The query sequence (length=63) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8wak:X | 63 | 63 | 1.0000 | 1.0000 | 1.0000 | 3.29e-29 | |
2 | 8wal:X | 63 | 63 | 0.9841 | 0.9841 | 0.9841 | 5.51e-27 | |
3 | 8wan:X | 63 | 63 | 0.9683 | 0.9683 | 0.9683 | 2.56e-25 | |
4 | 8wao:X | 63 | 63 | 0.9524 | 0.9524 | 0.9524 | 4.29e-23 | |
5 | 8was:Y | 73 | 66 | 0.9683 | 0.8356 | 0.9242 | 2.00e-21 | |
6 | 8wap:X | 63 | 63 | 0.9365 | 0.9365 | 0.9365 | 2.00e-21 | |
7 | 8war:Y | 73 | 67 | 0.9683 | 0.8356 | 0.9104 | 2.58e-20 | |
8 | 8waq:X | 63 | 63 | 0.9206 | 0.9206 | 0.9206 | 3.34e-19 | |
9 | 8waq:Y | 73 | 68 | 0.9683 | 0.8356 | 0.8971 | 1.20e-18 | |
10 | 8war:X | 63 | 63 | 0.9048 | 0.9048 | 0.9048 | 1.55e-17 | |
11 | 8wap:Y | 73 | 69 | 0.9683 | 0.8356 | 0.8841 | 1.55e-17 | |
12 | 8wao:Y | 73 | 70 | 0.9841 | 0.8493 | 0.8857 | 1.55e-17 | |
13 | 8wan:Y | 73 | 71 | 0.9841 | 0.8493 | 0.8732 | 2.01e-16 | |
14 | 8was:X | 63 | 63 | 0.8889 | 0.8889 | 0.8889 | 2.60e-15 | |
15 | 8wak:Y | 77 | 35 | 0.5556 | 0.4545 | 1.0000 | 1.21e-13 | |
16 | 8wak:Y | 77 | 30 | 0.4762 | 0.3896 | 1.0000 | 7.28e-11 | |
17 | 8wal:Y | 78 | 33 | 0.5238 | 0.4231 | 1.0000 | 1.56e-12 | |
18 | 8wal:Y | 78 | 30 | 0.4762 | 0.3846 | 1.0000 | 7.28e-11 |