aagctttattgaggcttaagcagtgggttcaaggtacta
The query sequence (length=39) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7okx:T | 39 | 39 | 1.0000 | 1.0000 | 1.0000 | 3.98e-16 | 7oky:T, 7ol0:T |
| 2 | 8p4c:T | 41 | 39 | 0.9744 | 0.9268 | 0.9744 | 1.85e-14 | 8p4d:T |
| 3 | 6gml:T | 45 | 39 | 0.9744 | 0.8444 | 0.9744 | 1.85e-14 | |
| 4 | 8p4a:T | 38 | 38 | 0.9487 | 0.9737 | 0.9737 | 6.67e-14 |
umich.edu