aacaaaatgattgacaaaagtgttaaattgtgctataatgggagctgtcacggatgcagggga
The query sequence (length=63) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7c97:H | 63 | 63 | 1.0000 | 1.0000 | 1.0000 | 3.29e-29 | 7chw:H, 7dy6:H |
| 2 | 7chw:G | 49 | 36 | 0.5714 | 0.7347 | 1.0000 | 3.36e-14 | |
| 3 | 7c97:G | 48 | 36 | 0.5556 | 0.7292 | 0.9722 | 5.63e-12 | 7dy6:G |
umich.edu