BioLiP

Download all results in tab-seperated text for 2 receptor-ligand interactions, whose format is explained at readme.txt.

Hover over PDB to view the title of the structure. Click PDB to view the structure at the RCSB PDB database. Resolution -1.00 means the resolution is unavailable, e.g., for NMR structures.

Click Site # to view the binding site structure. Hover over Site # to view the binding residues.

The sequence is converted from residues with experimentally determined coordinates in the structure; residues not observed in the 3D structure are excluded.

Hover over EC number to view the full name of enzymatic activity.

Hover over GO terms to view all GO terms.

Hover over UniProt to view the protein name.

<< < 1 > >>

#	PDB (resolution)	Site #	RNA sequence	EC number	GO terms	UniProt	PubMed	Binding affinity
1	8qbm:P (3.09)	BS01	>8qbm:R (identical to 8qbk:C, 8qbk:M, 8qbk:R, 8qbk:W, 8qbl:C, 8qbl:O, 8qbl:W, 8qbl:b, 8qbl:R, 8qbm:C, 8qbm:M, 8qbm:O, 8qbm:W, 8qbm:b) ugcgcacccuuagcgagaggccucuggauguugcggcauccugcauugaa ucugaguuacu ...............<<<<..>>>><<<<<<<..>>>>>>>......... ...........	2.7.7.49	GO:0003723 ...	P23070	38788717
2	8qbm:T (3.09)	BS01	>8qbm:R (identical to 8qbk:C, 8qbk:M, 8qbk:R, 8qbk:W, 8qbl:C, 8qbl:O, 8qbl:W, 8qbl:b, 8qbl:R, 8qbm:C, 8qbm:M, 8qbm:O, 8qbm:W, 8qbm:b) ugcgcacccuuagcgagaggccucuggauguugcggcauccugcauugaa ucugaguuacu ...............<<<<..>>>><<<<<<<..>>>>>>>......... ...........	?	GO:0051607 ...	P0DV88	38788717