# | PDB (resolution) |
Site # |
DNA
sequence |
EC number |
GO terms |
UniProt | PubMed | Binding affinity |
---|---|---|---|---|---|---|---|---|
1 | 6j51:B (4.2) |
BS03 | >6j51:N (identical to 6j4x:N, 6j4y:N)ctcgtgcctggtgtcttgaatccccttggcggttaaaacgcgggggacag cgcgtacgtgcgtttaagcggtgctagagctgtctacgaccaattgagcg gcctcggcaccgggattctgat |
2.7.7.6 | GO:0000428 ... | C4QZQ7 | 30733384 | |
2 | 6j51:W (4.2) |
BS02 | >6j51:N (identical to 6j4x:N, 6j4y:N)ctcgtgcctggtgtcttgaatccccttggcggttaaaacgcgggggacag cgcgtacgtgcgtttaagcggtgctagagctgtctacgaccaattgagcg gcctcggcaccgggattctgat |
? | GO:0003711 ... | C4R370 | 30733384 | |
3 | 6j51:a (4.2) |
BS02 | >6j51:N (identical to 6j4x:N, 6j4y:N)ctcgtgcctggtgtcttgaatccccttggcggttaaaacgcgggggacag cgcgtacgtgcgtttaagcggtgctagagctgtctacgaccaattgagcg gcctcggcaccgggattctgat |
? | GO:0000775 ... | P84243 | 30733384 | |
4 | 6j51:b (4.2) |
BS02 | >6j51:N (identical to 6j4x:N, 6j4y:N)ctcgtgcctggtgtcttgaatccccttggcggttaaaacgcgggggacag cgcgtacgtgcgtttaagcggtgctagagctgtctacgaccaattgagcg gcctcggcaccgggattctgat |
? | GO:0000781 ... | P62805 | 30733384 | |
5 | 6j51:c (4.2) |
BS02 | >6j51:N (identical to 6j4x:N, 6j4y:N)ctcgtgcctggtgtcttgaatccccttggcggttaaaacgcgggggacag cgcgtacgtgcgtttaagcggtgctagagctgtctacgaccaattgagcg gcctcggcaccgggattctgat |
? | GO:0000786 ... | P04908 | 30733384 | |
6 | 6j51:d (4.2) |
BS02 | >6j51:N (identical to 6j4x:N, 6j4y:N)ctcgtgcctggtgtcttgaatccccttggcggttaaaacgcgggggacag cgcgtacgtgcgtttaagcggtgctagagctgtctacgaccaattgagcg gcctcggcaccgggattctgat |
? | GO:0000786 ... | P06899 | 30733384 | |
7 | 6j51:e (4.2) |
BS02 | >6j51:N (identical to 6j4x:N, 6j4y:N)ctcgtgcctggtgtcttgaatccccttggcggttaaaacgcgggggacag cgcgtacgtgcgtttaagcggtgctagagctgtctacgaccaattgagcg gcctcggcaccgggattctgat |
? | GO:0000775 ... | P84243 | 30733384 | |
8 | 6j51:f (4.2) |
BS01 | >6j51:N (identical to 6j4x:N, 6j4y:N)ctcgtgcctggtgtcttgaatccccttggcggttaaaacgcgggggacag cgcgtacgtgcgtttaagcggtgctagagctgtctacgaccaattgagcg gcctcggcaccgggattctgat |
? | GO:0000781 ... | P62805 | 30733384 |