# | PDB (resolution) |
Site # |
DNA
sequence |
EC number |
GO terms |
UniProt | PubMed | Binding affinity |
---|---|---|---|---|---|---|---|---|
1 | 8sn9:A (3.9) |
BS02 | >8sn9:J (identical to 6dzt:I, 8pc5:J, 8pc6:J, 8peo:J, 8pep:J, 6pwe:I, 6r1t:I, 6r1u:I, 6r25:I, 7scy:I, 7scz:I, 8smw:J, 8smx:J, 8smy:J, 8smz:J, 8sn0:J, 8sn1:J, 8sn2:J, 8sn3:J, 8sn4:J, 8sn5:J, 8sn6:J, 8sn7:J, 8sn8:J, 8sna:J, 8txv:J, 8txw:J, 8txx:J)atcggatgtatatatctgacacgtgcctggagactagggagtaatcccct tggcggttaaaacgcgggggacagcgcgtacgtgcgtttaagcggtgcta gagctgtctacgaccaattgagcggcctcggcaccgggattctcgat |
? | GO:0000786 ... | P68431 | 38242129 | |
2 | 8sn9:B (3.9) |
BS02 | >8sn9:J (identical to 6dzt:I, 8pc5:J, 8pc6:J, 8peo:J, 8pep:J, 6pwe:I, 6r1t:I, 6r1u:I, 6r25:I, 7scy:I, 7scz:I, 8smw:J, 8smx:J, 8smy:J, 8smz:J, 8sn0:J, 8sn1:J, 8sn2:J, 8sn3:J, 8sn4:J, 8sn5:J, 8sn6:J, 8sn7:J, 8sn8:J, 8sna:J, 8txv:J, 8txw:J, 8txx:J)atcggatgtatatatctgacacgtgcctggagactagggagtaatcccct tggcggttaaaacgcgggggacagcgcgtacgtgcgtttaagcggtgcta gagctgtctacgaccaattgagcggcctcggcaccgggattctcgat |
? | GO:0000781 ... | P62805 | 38242129 | |
3 | 8sn9:C (3.9) |
BS02 | >8sn9:J (identical to 6dzt:I, 8pc5:J, 8pc6:J, 8peo:J, 8pep:J, 6pwe:I, 6r1t:I, 6r1u:I, 6r25:I, 7scy:I, 7scz:I, 8smw:J, 8smx:J, 8smy:J, 8smz:J, 8sn0:J, 8sn1:J, 8sn2:J, 8sn3:J, 8sn4:J, 8sn5:J, 8sn6:J, 8sn7:J, 8sn8:J, 8sna:J, 8txv:J, 8txw:J, 8txx:J)atcggatgtatatatctgacacgtgcctggagactagggagtaatcccct tggcggttaaaacgcgggggacagcgcgtacgtgcgtttaagcggtgcta gagctgtctacgaccaattgagcggcctcggcaccgggattctcgat |
? | GO:0000786 ... | P04908 | 38242129 | |
4 | 8sn9:D (3.9) |
BS02 | >8sn9:J (identical to 6dzt:I, 8pc5:J, 8pc6:J, 8peo:J, 8pep:J, 6pwe:I, 6r1t:I, 6r1u:I, 6r25:I, 7scy:I, 7scz:I, 8smw:J, 8smx:J, 8smy:J, 8smz:J, 8sn0:J, 8sn1:J, 8sn2:J, 8sn3:J, 8sn4:J, 8sn5:J, 8sn6:J, 8sn7:J, 8sn8:J, 8sna:J, 8txv:J, 8txw:J, 8txx:J)atcggatgtatatatctgacacgtgcctggagactagggagtaatcccct tggcggttaaaacgcgggggacagcgcgtacgtgcgtttaagcggtgcta gagctgtctacgaccaattgagcggcctcggcaccgggattctcgat |
? | GO:0000786 ... | P06899 | 38242129 | |
5 | 8sn9:E (3.9) |
BS02 | >8sn9:J (identical to 6dzt:I, 8pc5:J, 8pc6:J, 8peo:J, 8pep:J, 6pwe:I, 6r1t:I, 6r1u:I, 6r25:I, 7scy:I, 7scz:I, 8smw:J, 8smx:J, 8smy:J, 8smz:J, 8sn0:J, 8sn1:J, 8sn2:J, 8sn3:J, 8sn4:J, 8sn5:J, 8sn6:J, 8sn7:J, 8sn8:J, 8sna:J, 8txv:J, 8txw:J, 8txx:J)atcggatgtatatatctgacacgtgcctggagactagggagtaatcccct tggcggttaaaacgcgggggacagcgcgtacgtgcgtttaagcggtgcta gagctgtctacgaccaattgagcggcctcggcaccgggattctcgat |
? | GO:0000786 ... | P68431 | 38242129 | |
6 | 8sn9:F (3.9) |
BS02 | >8sn9:J (identical to 6dzt:I, 8pc5:J, 8pc6:J, 8peo:J, 8pep:J, 6pwe:I, 6r1t:I, 6r1u:I, 6r25:I, 7scy:I, 7scz:I, 8smw:J, 8smx:J, 8smy:J, 8smz:J, 8sn0:J, 8sn1:J, 8sn2:J, 8sn3:J, 8sn4:J, 8sn5:J, 8sn6:J, 8sn7:J, 8sn8:J, 8sna:J, 8txv:J, 8txw:J, 8txx:J)atcggatgtatatatctgacacgtgcctggagactagggagtaatcccct tggcggttaaaacgcgggggacagcgcgtacgtgcgtttaagcggtgcta gagctgtctacgaccaattgagcggcctcggcaccgggattctcgat |
? | GO:0000781 ... | P62805 | 38242129 | |
7 | 8sn9:G (3.9) |
BS02 | >8sn9:J (identical to 6dzt:I, 8pc5:J, 8pc6:J, 8peo:J, 8pep:J, 6pwe:I, 6r1t:I, 6r1u:I, 6r25:I, 7scy:I, 7scz:I, 8smw:J, 8smx:J, 8smy:J, 8smz:J, 8sn0:J, 8sn1:J, 8sn2:J, 8sn3:J, 8sn4:J, 8sn5:J, 8sn6:J, 8sn7:J, 8sn8:J, 8sna:J, 8txv:J, 8txw:J, 8txx:J)atcggatgtatatatctgacacgtgcctggagactagggagtaatcccct tggcggttaaaacgcgggggacagcgcgtacgtgcgtttaagcggtgcta gagctgtctacgaccaattgagcggcctcggcaccgggattctcgat |
? | GO:0000786 ... | P04908 | 38242129 | |
8 | 8sn9:H (3.9) |
BS02 | >8sn9:J (identical to 6dzt:I, 8pc5:J, 8pc6:J, 8peo:J, 8pep:J, 6pwe:I, 6r1t:I, 6r1u:I, 6r25:I, 7scy:I, 7scz:I, 8smw:J, 8smx:J, 8smy:J, 8smz:J, 8sn0:J, 8sn1:J, 8sn2:J, 8sn3:J, 8sn4:J, 8sn5:J, 8sn6:J, 8sn7:J, 8sn8:J, 8sna:J, 8txv:J, 8txw:J, 8txx:J)atcggatgtatatatctgacacgtgcctggagactagggagtaatcccct tggcggttaaaacgcgggggacagcgcgtacgtgcgtttaagcggtgcta gagctgtctacgaccaattgagcggcctcggcaccgggattctcgat |
? | GO:0000786 ... | P06899 | 38242129 |