BioLiP

Download all results in tab-seperated text for 5 receptor-ligand interactions, whose format is explained at readme.txt.

Hover over PDB to view the title of the structure. Click PDB to view the structure at the RCSB PDB database. Resolution -1.00 means the resolution is unavailable, e.g., for NMR structures.

Click Site # to view the binding site structure. Hover over Site # to view the binding residues.

The sequence is converted from residues with experimentally determined coordinates in the structure; residues not observed in the 3D structure are excluded.

Hover over EC number to view the full name of enzymatic activity.

Hover over GO terms to view all GO terms.

Hover over UniProt to view the protein name.

<< < 1 > >>

#	PDB (resolution)	Site #	RNA sequence	EC number	GO terms	UniProt	PubMed
1	8uu9:3 (3.1)	BS01	>8uu9:B (identical to 7nhn:B, 8uu4:B, 8uu5:B, 8uu6:B, 8uu7:B, 8uu8:B, 8uua:B) cugguaguuauggcgagaaggucacacccguucccaucccgaacacggua guuaagcuucucugcgccaaugguaguugggggcuucccccugcgagagu aggucgcugccggg <<<<<<<<....<<<<<<<<.....<<<<<<.............>>>>.. >>....>>>>>>.>><<<.......<<.<<<<<...>>>>>.>>...... .>>>.>>>>>>>>.	?	GO:0003735 ...	A0A0U4MT39	38407413
2	8uu9:F (3.1)	BS02	>8uu9:B (identical to 7nhn:B, 8uu4:B, 8uu5:B, 8uu6:B, 8uu7:B, 8uu8:B, 8uua:B) cugguaguuauggcgagaaggucacacccguucccaucccgaacacggua guuaagcuucucugcgccaaugguaguugggggcuucccccugcgagagu aggucgcugccggg <<<<<<<<....<<<<<<<<.....<<<<<<.............>>>>.. >>....>>>>>>.>><<<.......<<.<<<<<...>>>>>.>>...... .>>>.>>>>>>>>.	?	GO:0000049 ...	A0A0U5AWX6	38407413
3	8uu9:O (3.1)	BS02	>8uu9:B (identical to 7nhn:B, 8uu4:B, 8uu5:B, 8uu6:B, 8uu7:B, 8uu8:B, 8uua:B) cugguaguuauggcgagaaggucacacccguucccaucccgaacacggua guuaagcuucucugcgccaaugguaguugggggcuucccccugcgagagu aggucgcugccggg <<<<<<<<....<<<<<<<<.....<<<<<<.............>>>>.. >>....>>>>>>.>><<<.......<<.<<<<<...>>>>>.>>...... .>>>.>>>>>>>>.	?	GO:0000049 ...	A0A0U4VSU8	38407413
4	8uu9:Q (3.1)	BS02	>8uu9:B (identical to 7nhn:B, 8uu4:B, 8uu5:B, 8uu6:B, 8uu7:B, 8uu8:B, 8uua:B) cugguaguuauggcgagaaggucacacccguucccaucccgaacacggua guuaagcuucucugcgccaaugguaguugggggcuucccccugcgagagu aggucgcugccggg <<<<<<<<....<<<<<<<<.....<<<<<<.............>>>>.. >>....>>>>>>.>><<<.......<<.<<<<<...>>>>>.>>...... .>>>.>>>>>>>>.	?	GO:0003735 ...	A0A0U5AR65	38407413
5	8uu9:Y (3.1)	BS02	>8uu9:B (identical to 7nhn:B, 8uu4:B, 8uu5:B, 8uu6:B, 8uu7:B, 8uu8:B, 8uua:B) cugguaguuauggcgagaaggucacacccguucccaucccgaacacggua guuaagcuucucugcgccaaugguaguugggggcuucccccugcgagagu aggucgcugccggg <<<<<<<<....<<<<<<<<.....<<<<<<.............>>>>.. >>....>>>>>>.>><<<.......<<.<<<<<...>>>>>.>>...... .>>>.>>>>>>>>.	?	GO:0003735 ...	A0A660JMC7	38407413