Alignment result for job RA882388938

Name of Chain_1: RA882388938A.pdb (to be superimposed onto Chain_2)
Name of Chain_2: RA882388938B.pdb
Length of Chain_1: 71 residues
Length of Chain_2: 67 residues

Aligned length= 67, RMSD=   1.20, Seq_ID=n_identical/n_aligned= 0.612
TM-score= 0.81266 (if normalized by length of Chain_1, i.e., LN=71, d0=2.54)
TM-score= 0.84976 (if normalized by length of Chain_2, i.e., LN=67, d0=2.39)
(You should use TM-score normalized by length of the reference structure)

(":" denotes residue pairs of d <  5.0 Angstrom, "." denotes other aligned residues)
cgcuucauauaauccuaaugauaugguuugggaguuucuaccaagagccuuaaacucuugauuaugaagug
  ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.  
--gaucauauaaucgcguggauauggcacgcaaguuucuaccgggcaccguaaauguccgacuaugguc--

Total CPU time is  0.02 seconds 

Superposition (Chain_1 in blue and Chain_2 in red)

(water of Chain_1 and Chain_2 in blue and red, respectively; non-water ligand of Chain_1 and Chain_2 in cyan and pink, respectively).

Result download

• Chain_1 (before superposition): RA882388938A.pdb.
• Chain_2 (before superposition): RA882388938B.pdb.
• Chain_1 superposed to Chain_2 (with Chain_2): RA882388938.pdb.
• Chain_1 superposed to Chain_2 (without Chain_2): RA882388938super.pdb.
All the above files will be removed from the server after 2 days.

Reference:

• Sha Gong, Chengxin Zhang, Yang Zhang (2019) RNA-align: quick and accurate alignment of RNA 3D structures based on size-independent TM-score_RNA. DOI: 10.1093/bioinformatics/btz282