uuucuauuuacguuuuaguacucuggaaacagaaucuacuaaaacaaggcaaaaugccguguuuaucucgucaacguugg
cgagau
The query sequence (length=86) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8jft:B | 86 | 86 | 1.0000 | 1.0000 | 1.0000 | 1.44e-40 | 8jg9:B, 8jg9:E |
| 2 | 7enr:B | 92 | 87 | 1.0000 | 0.9348 | 0.9885 | 6.71e-39 | |
| 3 | 7vw3:B | 104 | 77 | 0.8721 | 0.7212 | 0.9740 | 1.13e-31 | |
| 4 | 7eni:B | 69 | 64 | 0.7442 | 0.9275 | 1.0000 | 2.45e-28 | |
| 5 | 5axw:B | 73 | 54 | 0.6279 | 0.7397 | 1.0000 | 8.87e-23 | 5czz:B, 7el1:B |
zhanggroup.org