BioLiP

>rna
uuggaauacagagaagauuagcauggccccugcgcaaggauga

The query sequence (length=43) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8r0a:6	59	43	1.0000	0.7288	1.0000	4.32e-17
2	8qpk:6	43	43	1.0000	1.0000	1.0000	4.32e-17
3	8ro1:6	101	39	0.9070	0.3861	1.0000	7.23e-15
4	8ro0:6	90	39	0.9070	0.4333	1.0000	7.23e-15
5	6zym:6	79	38	0.8837	0.4810	1.0000	2.60e-14
6	5z56:F	93	38	0.8837	0.4086	1.0000	2.60e-14	5z57:F, 5z58:F
7	8rm5:6	64	38	0.8837	0.5938	1.0000	2.60e-14
8	8r09:6	65	38	0.8837	0.5846	1.0000	2.60e-14	8r0b:6
9	8qpe:6	43	38	0.8837	0.8837	1.0000	2.60e-14
10	8qpa:6	47	38	0.8837	0.8085	1.0000	2.60e-14
11	8qoz:6	48	38	0.8837	0.7917	1.0000	2.60e-14	8qpb:6
12	8q7n:6	78	38	0.8837	0.4872	1.0000	2.60e-14
13	5o9z:6	90	38	0.8837	0.4222	1.0000	2.60e-14
14	5mqf:6	89	38	0.8837	0.4270	1.0000	2.60e-14
15	8h6k:6A	60	38	0.8837	0.6333	1.0000	2.60e-14
16	8h6e:6A	59	38	0.8837	0.6441	1.0000	2.60e-14	8h6l:6A, 8qzs:6
17	6ff4:6	95	38	0.8837	0.4000	1.0000	2.60e-14	6ff7:6, 8i0p:F
18	8ch6:d	93	38	0.8837	0.4086	1.0000	2.60e-14	7qtt:d
19	8c6j:6	97	38	0.8837	0.3918	1.0000	2.60e-14	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
20	6ahd:F	94	38	0.8837	0.4043	1.0000	2.60e-14	8qo9:6
21	3jb9:N	90	38	0.8605	0.4111	0.9737	1.21e-12
22	6ah0:F	69	35	0.7907	0.4928	0.9714	5.63e-11
23	6qx9:6	53	33	0.7442	0.6038	0.9697	7.28e-10	8qxd:6, 8r08:6
24	6qw6:6	42	33	0.7442	0.7619	0.9697	7.28e-10
25	8qp8:6	37	33	0.7442	0.8649	0.9697	7.28e-10	8qp9:6
26	8h6j:6A	54	33	0.7442	0.5926	0.9697	7.28e-10

[Back]