BioLiP

>rna
uggaacgauacagagaagauuagcauggccccugcgcaaggaugacauucgugaagcguauuuu

The query sequence (length=64) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8rm5:6	64	64	1.0000	1.0000	1.0000	1.65e-28
2	8r09:6	65	64	1.0000	0.9846	1.0000	1.65e-28	8r0b:6
3	6ahd:F	94	63	0.9844	0.6702	1.0000	5.92e-28	8qo9:6
4	8h6k:6A	60	60	0.9375	1.0000	1.0000	2.75e-26
5	5o9z:6	90	59	0.9219	0.6556	1.0000	9.90e-26
6	8h6e:6A	59	59	0.9219	1.0000	1.0000	9.90e-26	8h6l:6A, 8qzs:6
7	5z56:F	93	61	0.9219	0.6344	0.9672	5.96e-23	5z57:F, 5z58:F
8	8ch6:d	93	61	0.9062	0.6237	0.9508	2.77e-21	7qtt:d
9	8h6j:6A	54	51	0.7812	0.9259	0.9804	1.29e-19
10	6zym:6	79	47	0.7344	0.5949	1.0000	4.64e-19
11	8qpa:6	47	47	0.7344	1.0000	1.0000	4.64e-19
12	8qoz:6	48	47	0.7344	0.9792	1.0000	4.64e-19	8qpb:6
13	8q7n:6	78	47	0.7344	0.6026	1.0000	4.64e-19
14	6ff4:6	95	47	0.7344	0.4947	1.0000	4.64e-19	6ff7:6, 8i0p:F
15	8c6j:6	97	47	0.7344	0.4845	1.0000	4.64e-19	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
16	8r0a:6	59	57	0.8438	0.9153	0.9474	1.67e-18
17	8ro1:6	101	47	0.7188	0.4554	0.9787	2.16e-17
18	8ro0:6	90	47	0.7188	0.5111	0.9787	2.16e-17
19	5mqf:6	89	44	0.6875	0.4944	1.0000	2.16e-17
20	6ah0:F	69	54	0.7969	0.7391	0.9444	2.16e-17
21	8qpe:6	43	43	0.6719	1.0000	1.0000	7.76e-17
22	6qx9:6	53	52	0.7656	0.9245	0.9423	2.79e-16	8qxd:6, 8r08:6
23	3jb9:N	90	47	0.7031	0.5000	0.9574	1.00e-15
24	8qpk:6	43	38	0.5938	0.8837	1.0000	4.67e-14
25	6qw6:6	42	37	0.5625	0.8571	0.9730	7.82e-12
26	8qp8:6	37	34	0.5156	0.8919	0.9706	3.64e-10	8qp9:6

[Back]