gugguaaugcggccagguaacaaaucaauccucccacggugagcuuucuuuucaccauaauccaccuugggccuuuuuac
ucucgcguuguucggagcgggggcucaagauugaaaaaugcauugugaguucugcgcuaaagcaaaaaccuggggu
The query sequence (length=156) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8ovj:3 | 156 | 156 | 1.0000 | 1.0000 | 1.0000 | 3.57e-79 | |
2 | 8a3w:3 | 153 | 156 | 0.9808 | 1.0000 | 0.9808 | 4.66e-73 | |
3 | 8a98:3 | 161 | 165 | 0.9744 | 0.9441 | 0.9212 | 1.32e-58 | |
4 | 8rxh:L3 | 183 | 111 | 0.7051 | 0.6011 | 0.9910 | 1.72e-52 | 8rxx:L3 |
5 | 5t2a:E | 169 | 156 | 0.8974 | 0.8284 | 0.8974 | 4.82e-48 | |
6 | 6az3:3 | 177 | 111 | 0.6859 | 0.6045 | 0.9640 | 2.24e-46 | |
7 | 5t5h:E | 146 | 156 | 0.8846 | 0.9452 | 0.8846 | 8.07e-46 | |
8 | 8ove:BE | 166 | 168 | 0.9038 | 0.8494 | 0.8393 | 2.28e-36 | |
9 | 8ova:BE | 188 | 112 | 0.6474 | 0.5372 | 0.9018 | 8.19e-36 | |
10 | 3jcs:3 | 184 | 67 | 0.4038 | 0.3424 | 0.9403 | 6.47e-22 | |
11 | 4v8m:BE | 210 | 54 | 0.3205 | 0.2381 | 0.9259 | 8.42e-16 | |
12 | 4v8m:BE | 210 | 58 | 0.3333 | 0.2476 | 0.8966 | 3.92e-14 |