gugcucgcuucggcagcacauauacuaaaauuggaacgauacagagaagauuagcauggccccugcgcaaggaugacaca
uucgugaagcguu
The query sequence (length=93) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5z56:F | 93 | 93 | 1.0000 | 1.0000 | 1.0000 | 2.05e-44 | 5z57:F, 5z58:F |
2 | 8ch6:d | 93 | 93 | 0.9785 | 0.9785 | 0.9785 | 4.43e-41 | 7qtt:d |
3 | 5o9z:6 | 90 | 92 | 0.9677 | 1.0000 | 0.9783 | 5.73e-40 | |
4 | 6ahd:F | 94 | 92 | 0.9677 | 0.9574 | 0.9783 | 5.73e-40 | 8qo9:6 |
5 | 8c6j:6 | 97 | 97 | 1.0000 | 0.9588 | 0.9588 | 7.42e-39 | 9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F |
6 | 6ff4:6 | 95 | 95 | 0.9785 | 0.9579 | 0.9579 | 9.59e-38 | 6ff7:6, 8i0p:F |
7 | 6zym:6 | 79 | 79 | 0.8495 | 1.0000 | 1.0000 | 1.24e-36 | |
8 | 8q7n:6 | 78 | 78 | 0.8387 | 1.0000 | 1.0000 | 4.46e-36 | |
9 | 7abi:6 | 91 | 93 | 0.9462 | 0.9670 | 0.9462 | 5.77e-35 | |
10 | 7aav:6 | 73 | 75 | 0.7849 | 1.0000 | 0.9733 | 1.62e-30 | |
11 | 8ro1:6 | 101 | 90 | 0.8817 | 0.8119 | 0.9111 | 9.73e-28 | |
12 | 8ro0:6 | 90 | 88 | 0.8602 | 0.8889 | 0.9091 | 1.26e-26 | |
13 | 5mqf:6 | 89 | 96 | 0.9140 | 0.9551 | 0.8854 | 2.11e-24 | |
14 | 8r09:6 | 65 | 62 | 0.6452 | 0.9231 | 0.9677 | 2.72e-23 | 8r0b:6 |
15 | 8rm5:6 | 64 | 61 | 0.6344 | 0.9219 | 0.9672 | 9.80e-23 | |
16 | 8h6k:6A | 60 | 58 | 0.6022 | 0.9333 | 0.9655 | 4.56e-21 | |
17 | 8h6e:6A | 59 | 57 | 0.5914 | 0.9322 | 0.9649 | 1.64e-20 | 8h6l:6A, 8qzs:6 |
18 | 8qoz:6 | 48 | 48 | 0.5161 | 1.0000 | 1.0000 | 2.12e-19 | 8qpb:6 |
19 | 8qpa:6 | 47 | 47 | 0.5054 | 1.0000 | 1.0000 | 7.63e-19 | |
20 | 3jb9:N | 90 | 52 | 0.5376 | 0.5556 | 0.9615 | 2.74e-18 | |
21 | 7abg:6 | 78 | 46 | 0.4946 | 0.5897 | 1.0000 | 2.74e-18 | |
22 | 7abf:6 | 65 | 46 | 0.4946 | 0.7077 | 1.0000 | 2.74e-18 | |
23 | 8qpe:6 | 43 | 43 | 0.4624 | 1.0000 | 1.0000 | 1.28e-16 | |
24 | 8r0a:6 | 59 | 53 | 0.5269 | 0.8305 | 0.9245 | 2.14e-14 | |
25 | 8h6j:6A | 54 | 49 | 0.4946 | 0.8519 | 0.9388 | 2.14e-14 | |
26 | 8qpk:6 | 43 | 38 | 0.4086 | 0.8837 | 1.0000 | 7.68e-14 | |
27 | 6qx9:6 | 53 | 48 | 0.4731 | 0.8302 | 0.9167 | 1.29e-11 | 8qxd:6, 8r08:6 |
28 | 6ah0:F | 69 | 51 | 0.4946 | 0.6667 | 0.9020 | 1.29e-11 | |
29 | 6qw6:6 | 42 | 35 | 0.3656 | 0.8095 | 0.9714 | 1.66e-10 | |
30 | 8qp8:6 | 37 | 34 | 0.3548 | 0.8919 | 0.9706 | 5.98e-10 | 8qp9:6 |