gugcucgcuucggcagcacauauacuaaaauuggaacgauacagagaagauuagcauccccugcgcaaggaug
The query sequence (length=73) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7abi:6 | 91 | 73 | 1.0000 | 0.8022 | 1.0000 | 1.96e-33 | |
2 | 7aav:6 | 73 | 73 | 1.0000 | 1.0000 | 1.0000 | 1.96e-33 | |
3 | 6zym:6 | 79 | 75 | 1.0000 | 0.9241 | 0.9733 | 1.18e-30 | |
4 | 5z56:F | 93 | 75 | 1.0000 | 0.7849 | 0.9733 | 1.18e-30 | 5z57:F, 5z58:F |
5 | 8q7n:6 | 78 | 75 | 1.0000 | 0.9359 | 0.9733 | 1.18e-30 | |
6 | 5o9z:6 | 90 | 75 | 1.0000 | 0.8111 | 0.9733 | 1.18e-30 | |
7 | 6ff4:6 | 95 | 75 | 1.0000 | 0.7684 | 0.9733 | 1.18e-30 | 6ff7:6, 8i0p:F |
8 | 8ch6:d | 93 | 75 | 1.0000 | 0.7849 | 0.9733 | 1.18e-30 | 7qtt:d |
9 | 8c6j:6 | 97 | 75 | 1.0000 | 0.7526 | 0.9733 | 1.18e-30 | 9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F |
10 | 6ahd:F | 94 | 75 | 1.0000 | 0.7766 | 0.9733 | 1.18e-30 | 8qo9:6 |
11 | 7abg:6 | 78 | 46 | 0.6301 | 0.5897 | 1.0000 | 2.00e-18 | |
12 | 7abf:6 | 65 | 46 | 0.6301 | 0.7077 | 1.0000 | 2.00e-18 | |
13 | 5mqf:6 | 89 | 75 | 0.9041 | 0.7416 | 0.8800 | 9.32e-17 |