BioLiP

>rna
gguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaacccaauuuuuugaggcc
uugcaaggcu

The query sequence (length=90) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7dvq:B	90	90	1.0000	1.0000	1.0000	9.14e-43
2	7w59:B	84	84	0.9333	1.0000	1.0000	1.98e-39	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
3	8i0p:B	98	85	0.9333	0.8571	0.9882	9.20e-38	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
4	8ch6:e	98	86	0.9111	0.8367	0.9535	2.58e-33	7qtt:e
5	6qdv:5	75	76	0.8333	1.0000	0.9868	9.27e-33
6	9fmd:5	92	83	0.8889	0.8696	0.9639	9.27e-33	8ro2:5
7	8qzs:5	109	91	0.9333	0.7706	0.9231	2.01e-29	8y6o:B
8	6zym:5	74	64	0.7111	0.8649	1.0000	2.60e-28
9	8r09:5	112	64	0.7111	0.5714	1.0000	2.60e-28	8r0b:5, 8rm5:5
10	8qpk:5	77	64	0.7111	0.8312	1.0000	2.60e-28
11	8qoz:5	79	64	0.7111	0.8101	1.0000	2.60e-28	8qpa:5, 8qpb:5
12	6id0:B	98	64	0.7111	0.6531	1.0000	2.60e-28	6id1:B
13	6icz:B	97	64	0.7111	0.6598	1.0000	2.60e-28
14	8h6e:5A	114	64	0.7111	0.5614	1.0000	2.60e-28	8h6j:5A
15	6ff4:5	70	64	0.7111	0.9143	1.0000	2.60e-28	6ff7:5
16	8c6j:5	113	64	0.7111	0.5664	1.0000	2.60e-28
17	6ah0:B	115	64	0.7111	0.5565	1.0000	2.60e-28	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
18	7abg:5	114	64	0.7111	0.5614	1.0000	2.60e-28	7abi:5, 5mqf:5, 5o9z:5
19	7aav:5	69	64	0.7111	0.9275	1.0000	2.60e-28
20	7abf:5	58	58	0.6444	1.0000	1.0000	5.62e-25
21	8q7q:5	104	91	0.8778	0.7596	0.8681	5.66e-20	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
22	8qp8:5	71	64	0.6556	0.8310	0.9219	2.63e-18	8qp9:5
23	8ro1:5	111	39	0.4111	0.3333	0.9487	4.44e-11
24	8ro0:5	111	39	0.4111	0.3333	0.9487	4.44e-11

[Back]