ggucaauuugaaacaauacagagaugaucagcgguuccccuggaugaaccguuuuacaaagagac
The query sequence (length=65) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4n0t:B | 65 | 65 | 1.0000 | 1.0000 | 1.0000 | 4.68e-29 | |
2 | 5tf6:B | 71 | 71 | 0.9846 | 0.9014 | 0.9014 | 4.74e-19 | |
3 | 5y88:D | 101 | 70 | 0.9692 | 0.6238 | 0.9000 | 1.71e-18 | |
4 | 5mps:6 | 99 | 70 | 0.9692 | 0.6364 | 0.9000 | 1.71e-18 | 5mq0:6 |
5 | 5lj3:V | 97 | 70 | 0.9692 | 0.6495 | 0.9000 | 1.71e-18 | 5lj5:V |
6 | 7dco:F | 103 | 70 | 0.9692 | 0.6117 | 0.9000 | 1.71e-18 | 5gm6:E, 5gmk:E, 6j6g:E, 6j6h:E, 6j6n:E, 6j6q:E, 5wsg:E, 5ylz:D |
7 | 7b9v:6 | 102 | 70 | 0.9692 | 0.6176 | 0.9000 | 1.71e-18 | 6bk8:6, 6exn:6, 5lqw:6 |
8 | 5vsu:I | 73 | 65 | 0.9077 | 0.8082 | 0.9077 | 2.21e-17 | |
9 | 6aso:I | 70 | 65 | 0.9077 | 0.8429 | 0.9077 | 2.21e-17 | |
10 | 5tf6:D | 52 | 32 | 0.4923 | 0.6154 | 1.0000 | 1.03e-10 |