Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●D-I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●D-QUARK ●DRfold ●DRfold2 ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●DeepMSA2 ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP Library
>rna
gggugauuagcucauggagcaccucccuuacaaggaggggcggcgguucgaucccgucaucacccacca

The query sequence (length=69) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 5ibb:1L 69 69 1.0000 1.0000 1.0000 3.04e-31
2 5ibb:1K 72 72 1.0000 0.9583 0.9583 8.50e-27
3 5ibb:3K 70 70 0.9710 0.9571 0.9571 3.06e-26
4 5ibb:3L 71 71 0.9710 0.9437 0.9437 3.96e-25
5 6cae:1w 73 73 0.9855 0.9315 0.9315 5.12e-24 6cae:2y, 6nd6:1w, 6nd6:2w, 6nd6:2y, 6o97:1w, 6o97:1y, 6o97:2w, 6o97:2y, 6of1:1w, 6of1:1y, 6of1:2w, 6of1:2y
6 6cae:1y 74 74 0.9855 0.9189 0.9189 2.38e-22 7k00:Y, 6nd6:1y, 8pva:Y
7 4w29:AX 77 76 1.0000 0.8961 0.9079 3.08e-21 4w29:CX
8 6by1:AV 76 76 1.0000 0.9079 0.9079 3.08e-21 6by1:AY, 6by1:AW, 6by1:BV, 6by1:BW, 6n1d:APTN, 6n1d:BPTN, 8peg:Y, 4v6y:A1, 4v71:A1, 4v72:A1, 4v73:A1, 4v74:A1, 4v75:A1, 4v76:A1, 4v77:A1, 4v78:A1, 4v79:A1, 4v7a:A1
9 7b5k:9 76 76 1.0000 0.9079 0.9079 3.08e-21

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417