Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
gggucguuagcucaggguagagcaguugacuuuuaaucaauuggcgcagguucgaauccugcacgacccacca

The query sequence (length=73) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 7zta:PTR1 73 73 1.0000 1.0000 1.0000 1.96e-33
2 5el4:3L 74 74 1.0000 0.9865 0.9865 9.12e-32
3 8fom:QV 74 74 0.9863 0.9730 0.9730 4.24e-30 8fom:XV, 8fon:QV, 8fon:XV
4 8bhj:5 76 76 1.0000 0.9605 0.9605 5.49e-29 8bhn:5, 5e7k:3K, 5e7k:3L, 5el4:3K, 5el5:3K, 5el6:3K, 5el7:3K, 5gak:A, 6hd7:A, 5mc6:m, 7n1p:Pt, 7n2c:Pt, 7n2v:Pt, 7n31:Pt, 7nrc:Sm, 6tnu:m, 5uyn:Y, 5uyp:Y, 5uyq:Y
5 5e81:3L 72 74 0.9726 0.9861 0.9595 7.10e-28
6 5e81:1K 72 73 0.9589 0.9722 0.9589 7.10e-28 5ib7:1K, 5ib8:1K
7 7rr5:A 76 76 0.9863 0.9474 0.9474 2.55e-27
8 5el7:3L 75 76 0.9863 0.9600 0.9474 2.55e-27
9 5e81:3K 70 73 0.9589 1.0000 0.9589 2.55e-27 5ib7:3K, 5ib8:3K
10 5el4:1L 74 75 0.9726 0.9595 0.9467 9.18e-27 5el5:1L
11 5e7k:1L 73 75 0.9726 0.9726 0.9467 9.18e-27 5el6:1L
12 5e7k:1K 71 73 0.9452 0.9718 0.9452 3.30e-26
13 5el4:1K 69 73 0.9315 0.9855 0.9315 5.53e-24 5el5:1K, 5el6:1K, 5el7:1K
14 5e81:1L 69 73 0.9315 0.9855 0.9315 5.53e-24

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218