gggaaggguuucgacccuucccaauauggcuguucgccauuu
The query sequence (length=42) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7pmq:E | 42 | 42 | 1.0000 | 1.0000 | 1.0000 | 1.49e-16 | 7pmq:F, 7pmq:G, 7pmq:H |
| 2 | 7pmm:D | 44 | 29 | 0.6905 | 0.6591 | 1.0000 | 2.51e-09 |
umich.edu