ggcuacguagcucaguugguuagagcacaucacucauaaugauggggucacagguucgaaucccgucguagccacca
The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7uo1:C | 82 | 77 | 1.0000 | 0.9390 | 1.0000 | 1.26e-35 | |
2 | 6q97:8 | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 1.26e-35 | 4v7b:AW, 4v9j:AW, 4v9j:CW, 4v9k:AW, 4v9k:CW, 4v9l:AW, 4v9l:CW, 4v9m:AW, 4v9m:CW, 4w29:AW, 4w29:CW |
3 | 7q4k:D2 | 76 | 77 | 0.9870 | 1.0000 | 0.9870 | 2.11e-33 | |
4 | 5mrc:bb | 76 | 77 | 0.9870 | 1.0000 | 0.9870 | 2.11e-33 | 5mre:bb, 5mrf:bb |