ggccgccgccaccggggugguccccgggccggacuagauccggcgcgccccgaguggggcgcgggguucaauuccccgcg
gcggccgc
The query sequence (length=88) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 3add:D | 88 | 88 | 1.0000 | 1.0000 | 1.0000 | 1.15e-41 | |
| 2 | 3adb:C | 92 | 90 | 1.0000 | 0.9565 | 0.9778 | 6.91e-39 | 3adb:D, 3adc:D |
| 3 | 3adc:C | 88 | 88 | 0.9773 | 0.9773 | 0.9773 | 8.95e-38 | 3add:C |
umich.edu