ggcccggauagcucagucgguagagcaucagacuuaaucugaggguccaggguucaagucccuguucgggcgcc
The query sequence (length=74) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5cd1:M | 74 | 74 | 1.0000 | 1.0000 | 1.0000 | 5.55e-34 | |
2 | 5cd1:N | 76 | 76 | 1.0000 | 0.9737 | 0.9737 | 3.34e-31 | |
3 | 5ccb:N | 77 | 76 | 1.0000 | 0.9610 | 0.9737 | 3.34e-31 | 5ccx:N |
4 | 6sgc:23 | 76 | 75 | 0.9595 | 0.9342 | 0.9467 | 2.60e-27 | 6sgc:33 |
5 | 7nwg:33 | 75 | 76 | 0.9730 | 0.9600 | 0.9474 | 2.60e-27 | |
6 | 6r5q:3 | 75 | 75 | 0.9595 | 0.9467 | 0.9467 | 9.35e-27 | 6r6g:3, 6r6p:3, 6r7q:3 |
7 | 3jag:3 | 75 | 75 | 0.9595 | 0.9467 | 0.9467 | 9.35e-27 | 3jah:3, 3jai:3, 5lzs:3, 5lzt:3, 5lzu:3, 5lzv:3, 5lzw:3, 5lzx:3, 5lzy:2, 5lzy:3, 5lzz:3, 6mtb:4, 6mtc:4, 8scb:3 |
8 | 8d9k:C | 65 | 70 | 0.8784 | 1.0000 | 0.9286 | 9.42e-22 | 8d9l:C, 8eg0:C |
9 | 7mrl:A | 75 | 73 | 0.8919 | 0.8800 | 0.9041 | 4.38e-20 | |
10 | 6wb1:D | 42 | 30 | 0.4054 | 0.7143 | 1.0000 | 1.60e-09 | 6wb2:D |