ggauggcaagauccugguaugcuggggagccugaaaaggcuaccuagcaagaccccuucguggggucgcauucuucaccc
ccaggggguuc
The query sequence (length=91) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6wbr:B | 91 | 91 | 1.0000 | 1.0000 | 1.0000 | 2.58e-43 | 6wc0:B |
2 | 8d2l:B | 97 | 93 | 1.0000 | 0.9381 | 0.9785 | 1.55e-40 | |
3 | 8d2k:B | 102 | 82 | 0.9011 | 0.8039 | 1.0000 | 2.60e-38 | 8d2p:B |
4 | 8d2n:B | 92 | 77 | 0.8462 | 0.8370 | 1.0000 | 1.56e-35 | |
5 | 8d2o:B | 87 | 77 | 0.8022 | 0.8391 | 0.9481 | 9.47e-28 | |
6 | 8d2q:B | 86 | 76 | 0.7912 | 0.8372 | 0.9474 | 3.40e-27 |