BioLiP

>rna
gcggauuuagcucaguugggagagcgccagacugaagaucuggagguccuguguucgauccacagaauucgcaccaf

The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	1ob2:B	76	76	0.9870	1.0000	1.0000	4.45e-35
2	8ccs:Bb	76	76	0.9870	1.0000	1.0000	4.45e-35	8cdl:Bb, 8cdr:Bb, 8ceh:Bb, 8cf5:Bb, 8cg8:Bb, 8civ:Bb, 8cku:Bb, 3deg:A, 6gq1:AX, 6gqb:AX, 6gqv:AY, 3izy:N, 5m1j:A3, 1mj1:D, 1ml5:B, 1sz1:E, 1sz1:F, 1ttt:D, 1ttt:E, 1ttt:F, 4v49:AV, 4v4p:BB, 4v4p:BC, 4v4r:AV, 4v4r:AW, 4v4s:AV, 4v4s:AW, 4v4t:AV, 4v4t:AW, 4v4v:AU, 4v4v:AV, 4v4v:AW, 4v4w:AW, 4v65:AE, 4v66:AE, 4v69:AY, 4v7h:A7, 6xiq:AX, 6xz7:g, 6xzb:g2
3	4v65:AA	75	75	0.9740	1.0000	1.0000	1.60e-34	4v65:AP, 4v66:AP
4	1ob5:B	76	74	0.9610	0.9737	1.0000	5.75e-34	1ob5:D, 1ob5:F
5	8cth:C	74	74	0.9610	1.0000	1.0000	5.75e-34
6	6xir:AZ	73	73	0.9481	1.0000	1.0000	2.07e-33
7	4v4i:0	76	76	0.9740	0.9868	0.9868	2.07e-33	4v4j:2
8	6ah3:T	80	73	0.9481	0.9125	1.0000	2.07e-33
9	6lvr:D	72	72	0.9351	1.0000	1.0000	7.44e-33	6lvr:B
10	6gz3:Bw	76	76	0.9610	0.9737	0.9737	9.63e-32	6gz4:Bw, 6gz5:Bw
11	3wc2:P	74	74	0.9351	0.9730	0.9730	1.25e-30
12	3wc2:Q	73	73	0.9221	0.9726	0.9726	4.48e-30
13	5axm:P	73	66	0.8571	0.9041	1.0000	1.61e-29
14	4v68:AY	72	76	0.9351	1.0000	0.9474	2.70e-27
15	4cxg:Y	76	76	0.8961	0.9079	0.9079	2.10e-23	4cxh:Y
16	5axn:P	66	66	0.7662	0.8939	0.8939	1.27e-15
17	8bsj:x	74	78	0.8571	0.8919	0.8462	1.65e-14
18	3icq:D	62	35	0.4545	0.5645	1.0000	2.75e-12
19	3icq:E	62	34	0.4416	0.5484	1.0000	9.90e-12

[Back]