BioLiP

>rna
gcggauuuagcucaguugggagagcgccagacugaagaucuggagguccuguguucgauccacagaauucgcacc

The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	4v65:AA	75	75	1.0000	1.0000	1.0000	1.57e-34	4v65:AP, 4v66:AP
2	1ob2:B	76	75	1.0000	0.9868	1.0000	1.57e-34
3	8ccs:Bb	76	75	1.0000	0.9868	1.0000	1.57e-34	8cdl:Bb, 8cdr:Bb, 8ceh:Bb, 8cf5:Bb, 8cg8:Bb, 8civ:Bb, 8cku:Bb, 3deg:A, 6gq1:AX, 6gqb:AX, 6gqv:AY, 3izy:N, 5m1j:A3, 1mj1:D, 1ml5:B, 1sz1:E, 1sz1:F, 1ttt:D, 1ttt:E, 1ttt:F, 4v49:AV, 4v4p:BB, 4v4p:BC, 4v4r:AV, 4v4r:AW, 4v4s:AV, 4v4s:AW, 4v4t:AV, 4v4t:AW, 4v4v:AU, 4v4v:AV, 4v4v:AW, 4v4w:AW, 4v65:AE, 4v66:AE, 4v69:AY, 4v7h:A7, 6xiq:AX, 6xz7:g, 6xzb:g2
4	1ob5:B	76	74	0.9867	0.9737	1.0000	5.65e-34	1ob5:D, 1ob5:F
5	8cth:C	74	74	0.9867	1.0000	1.0000	5.65e-34
6	6xir:AZ	73	73	0.9733	1.0000	1.0000	2.03e-33
7	6ah3:T	80	73	0.9733	0.9125	1.0000	2.03e-33
8	4v4i:0	76	75	0.9867	0.9737	0.9867	7.31e-33	4v4j:2
9	6lvr:D	72	72	0.9600	1.0000	1.0000	7.31e-33	6lvr:B
10	6gz3:Bw	76	75	0.9733	0.9605	0.9733	3.40e-31	6gz4:Bw, 6gz5:Bw
11	3wc2:P	74	74	0.9600	0.9730	0.9730	1.22e-30
12	3wc2:Q	73	73	0.9467	0.9726	0.9726	4.40e-30
13	5axm:P	73	66	0.8800	0.9041	1.0000	1.58e-29
14	4v68:AY	72	75	0.9467	0.9861	0.9467	9.52e-27
15	4cxg:Y	76	75	0.9067	0.8947	0.9067	7.42e-23	4cxh:Y
16	5axn:P	66	66	0.7867	0.8939	0.8939	1.25e-15
17	8bsj:x	74	77	0.8667	0.8784	0.8442	5.81e-14
18	3icq:D	62	34	0.4533	0.5484	1.0000	9.73e-12
19	3icq:E	62	33	0.4400	0.5323	1.0000	3.50e-11

[Back]