BioLiP

>rna
gcggauuuagcucaguugggagagcgccagacugaaaaucuggagguccuguguucgauccacagaauucgcacca

The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	4v4i:0	76	76	1.0000	1.0000	1.0000	4.45e-35	4v4j:2
2	1ob2:B	76	76	0.9868	0.9868	0.9868	2.07e-33
3	8ccs:Bb	76	76	0.9868	0.9868	0.9868	2.07e-33	8cdl:Bb, 8cdr:Bb, 8ceh:Bb, 8cf5:Bb, 8cg8:Bb, 8civ:Bb, 8cku:Bb, 3deg:A, 6gq1:AX, 6gqb:AX, 6gqv:AY, 3izy:N, 5m1j:A3, 1mj1:D, 1ml5:B, 1sz1:E, 1sz1:F, 1ttt:D, 1ttt:E, 1ttt:F, 4v49:AV, 4v4p:BB, 4v4p:BC, 4v4r:AV, 4v4r:AW, 4v4s:AV, 4v4s:AW, 4v4t:AV, 4v4t:AW, 4v4v:AU, 4v4v:AV, 4v4v:AW, 4v4w:AW, 4v65:AE, 4v66:AE, 4v69:AY, 4v7h:A7, 6xiq:AX, 6xz7:g, 6xzb:g2
4	4v65:AA	75	75	0.9737	0.9867	0.9867	7.44e-33	4v65:AP, 4v66:AP
5	1ob5:B	76	74	0.9605	0.9605	0.9865	2.68e-32	1ob5:D, 1ob5:F
6	8cth:C	74	74	0.9605	0.9865	0.9865	2.68e-32
7	6xir:AZ	73	73	0.9474	0.9863	0.9863	9.63e-32
8	6ah3:T	80	73	0.9474	0.9000	0.9863	9.63e-32
9	6lvr:D	72	72	0.9342	0.9861	0.9861	3.46e-31	6lvr:B
10	6gz3:Bw	76	76	0.9605	0.9605	0.9605	4.48e-30	6gz4:Bw, 6gz5:Bw
11	3wc2:P	74	74	0.9342	0.9595	0.9595	5.79e-29
12	3wc2:Q	73	73	0.9211	0.9589	0.9589	2.08e-28
13	5axm:P	73	66	0.8553	0.8904	0.9848	7.49e-28
14	4v68:AY	72	76	0.9342	0.9861	0.9342	1.25e-25
15	4cxg:Y	76	76	0.9211	0.9211	0.9211	4.51e-25	4cxh:Y
16	8bsj:x	74	76	0.8553	0.8784	0.8553	3.54e-16
17	5axn:P	66	66	0.7763	0.8939	0.8939	1.27e-15
18	3icq:D	62	35	0.4605	0.5645	1.0000	2.75e-12
19	3icq:E	62	34	0.4474	0.5484	1.0000	9.90e-12

[Back]