gcccggaugauccucaguggucuggggugcaggcuucaaaccuguagcugucuagcgacagagugguucaauuccaccuu
ucgggcgcca
The query sequence (length=90) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7zjw:F | 90 | 90 | 1.0000 | 1.0000 | 1.0000 | 9.14e-43 | |
2 | 8g9z:E | 87 | 89 | 0.9667 | 1.0000 | 0.9775 | 2.56e-38 | |
3 | 4rqe:B | 84 | 84 | 0.9111 | 0.9762 | 0.9762 | 1.54e-35 | |
4 | 4rqe:D | 83 | 83 | 0.9000 | 0.9759 | 0.9759 | 5.54e-35 | |
5 | 7mdl:E | 84 | 89 | 0.9333 | 1.0000 | 0.9438 | 3.33e-32 | |
6 | 3hl2:E | 82 | 89 | 0.9111 | 1.0000 | 0.9213 | 2.60e-28 | |
7 | 4zdo:E | 75 | 87 | 0.8333 | 1.0000 | 0.8621 | 9.47e-18 | |
8 | 4zdp:E | 74 | 87 | 0.8222 | 1.0000 | 0.8506 | 1.58e-15 | |
9 | 4rqf:C | 63 | 36 | 0.4000 | 0.5714 | 1.0000 | 9.54e-13 |