gcagagguucuagcuacacccucuauaaaaaacuaaggaccacacga
The query sequence (length=47) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8g8z:R | 48 | 47 | 1.0000 | 0.9792 | 1.0000 | 3.00e-19 | |
| 2 | 8f3c:R | 47 | 47 | 1.0000 | 1.0000 | 1.0000 | 3.00e-19 | 8g00:R, 8g1s:R, 8g2w:R, 8g4w:R, 8g7e:R |
zhanggroup.org