gaguacgaccacacuugagugaaaacaccauaucccguccgauuugugaaguuaagcacucacaggcucaguuaguacug
aggucagugaugacucgggaacccugagugccguacuccu
The query sequence (length=120) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8rxh:L8 | 120 | 120 | 1.0000 | 1.0000 | 1.0000 | 2.74e-59 | |
| 2 | 8a3w:8 | 119 | 119 | 0.9917 | 1.0000 | 1.0000 | 9.84e-59 | 8ovj:8, 8rxx:L8, 5t2a:D |
| 3 | 6az3:8 | 118 | 118 | 0.9750 | 0.9915 | 0.9915 | 1.65e-56 | |
| 4 | 8a98:8 | 118 | 118 | 0.9750 | 0.9915 | 0.9915 | 5.92e-56 | |
| 5 | 3jcs:8 | 119 | 118 | 0.9667 | 0.9748 | 0.9831 | 2.76e-54 | |
| 6 | 8ova:BD | 119 | 117 | 0.8000 | 0.8067 | 0.8205 | 4.81e-22 | 8ove:BD, 4v8m:BD |
umich.edu