Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
gacuuaaugucacgguacccaauuuucugcccc

The query sequence (length=33) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 7y8t:D 37 33 1.0000 0.8919 1.0000 1.00e-11 7y8y:D
2 7y82:B 41 33 1.0000 0.8049 1.0000 1.00e-11
3 7xsq:D 34 33 1.0000 0.9706 1.0000 1.00e-11 7xsr:D, 7xss:D, 7xt4:r
4 7xso:D 35 33 1.0000 0.9429 1.0000 1.00e-11 7xsp:D, 7y80:B, 7y84:B
5 7x7r:C 36 33 1.0000 0.9167 1.0000 1.00e-11
6 8d9f:C 33 33 1.0000 1.0000 1.0000 1.00e-11 8gu6:C, 7x7a:C, 7x8a:C
7 8d9e:C 36 33 1.0000 0.9167 1.0000 1.00e-11 8d9g:C, 8d9h:C, 7y81:B, 7y83:B, 7y85:B
8 8gna:C 32 32 0.9697 1.0000 1.0000 3.61e-11
9 8d8n:C 35 32 0.9697 0.9143 1.0000 3.61e-11 8d9i:C
10 7xc7:C 31 31 0.9394 1.0000 1.0000 1.30e-10
11 8d97:C 42 30 0.9091 0.7143 1.0000 4.67e-10

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218