BioLiP

>rna
cuggugacuauagcaaggaggucacaccuguucccaugccgaacacagaaguuaagcuccuuagcgucgaugguagucga
acuuacguuccgcuagaguagaacguugcaa

The query sequence (length=111) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7ttu:2	111	111	1.0000	1.0000	1.0000	2.51e-54	7ttw:2
2	6s0z:B	114	109	0.9820	0.9561	1.0000	3.25e-53
3	7nhl:B	113	109	0.9820	0.9646	1.0000	3.25e-53	7nhm:B, 8p2f:B, 8p2g:B, 8p2h:B, 7p48:B
4	7asm:B	115	109	0.9820	0.9478	1.0000	3.25e-53	6fxc:AB, 6fxc:BB, 6hma:B, 5ngm:AB, 6s0x:B, 6s12:B, 6s13:B, 8y36:B, 8y37:B, 8y38:B, 8y39:B, 6yef:B
5	6sj6:B	112	109	0.9730	0.9643	0.9908	5.43e-51
6	6ddd:2	104	104	0.9369	1.0000	1.0000	1.95e-50	6ddg:2
7	5t7v:C	114	109	0.9640	0.9386	0.9817	2.53e-49
8	6wru:2	112	107	0.9459	0.9375	0.9813	9.09e-49
9	6wqn:2	111	107	0.9459	0.9459	0.9813	9.09e-49	6wqq:2, 6wrs:2
10	7aso:C	114	109	0.9369	0.9123	0.9541	2.55e-44	7asp:3, 5hkv:Y, 5hl7:Y, 5li0:B, 5nd8:B, 5nd9:B, 5nrg:Y, 5tcu:C, 4wce:Y, 4wf9:Y, 4wfa:Y, 4wfb:Y
11	7asn:B	106	98	0.8559	0.8962	0.9694	5.51e-41
12	6o8w:B	116	80	0.6306	0.6034	0.8750	7.33e-20	6o8x:B, 6o8y:B, 6o8z:B, 6o90:B, 6w6p:B, 6wu9:B
13	7nhk:B	114	80	0.6306	0.6140	0.8750	7.33e-20	7p7q:B, 7p7r:B, 7p7s:B, 7p7t:B, 7p7u:B

[Back]