BioLiP

>rna
cgcuucucggccuuuuggcuaagaucaaguguaguaucuguucuuaucaguuuaauaucugauguccucucgaggacgga
uuuuuggagcagggagauggaauaggagcuugcuccguccacuccacgcaucgaccugguauugcaguaccuccaggaac
ggugc

The query sequence (length=165) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8i0r:H	167	165	1.0000	0.9880	1.0000	3.78e-84	8i0s:H, 8i0t:H, 8i0u:H
2	8i0p:H	165	165	1.0000	1.0000	1.0000	3.78e-84
3	7abi:2	164	166	0.9879	0.9939	0.9819	1.37e-78
4	7evo:H	148	149	0.8788	0.9797	0.9732	1.80e-67	8hk1:H, 6y5q:2
5	7vpx:H	130	134	0.7879	1.0000	0.9701	3.92e-59
6	7abg:2	145	137	0.7939	0.9034	0.9562	6.56e-57
7	8i0v:H	151	165	0.9030	0.9868	0.9030	5.11e-53
8	6y53:2	98	97	0.5818	0.9796	0.9897	4.00e-44
9	7a5p:2	155	88	0.5333	0.5677	1.0000	2.41e-41
10	8ch6:f	137	96	0.5636	0.6788	0.9688	1.12e-39
11	8ch6:f	137	42	0.2545	0.3066	1.0000	8.98e-16
12	5z56:H	136	96	0.5576	0.6765	0.9583	5.22e-38	5z57:H, 5z58:H
13	5z56:H	136	42	0.2545	0.3088	1.0000	8.98e-16	5z57:H, 5z58:H
14	5mqf:2	140	165	0.8303	0.9786	0.8303	3.16e-30
15	8c6j:2	142	165	0.8303	0.9648	0.8303	3.16e-30
16	7qtt:f	76	77	0.4485	0.9737	0.9610	4.09e-29
17	9fmd:2	120	58	0.3515	0.4833	1.0000	1.15e-24	6qdv:2
18	9fmd:2	120	38	0.2303	0.3167	1.0000	1.50e-13	6qdv:2
19	6ff4:2	60	62	0.3636	1.0000	0.9677	5.33e-23	6ff7:2
20	6id0:H	140	59	0.3455	0.4071	0.9661	2.48e-21
21	6id0:H	140	38	0.2303	0.2714	1.0000	1.50e-13
22	5o9z:2	100	48	0.2909	0.4800	1.0000	4.15e-19
23	6y50:2	50	47	0.2848	0.9400	1.0000	1.49e-18
24	6id1:H	136	45	0.2727	0.3309	1.0000	1.93e-17
25	6id1:H	136	38	0.2303	0.2794	1.0000	1.50e-13
26	6icz:H	140	45	0.2727	0.3214	1.0000	1.93e-17	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
27	6icz:H	140	42	0.2545	0.3000	1.0000	8.98e-16	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
28	8i0w:H	139	45	0.2727	0.3237	1.0000	1.93e-17	5yzg:H
29	8i0w:H	139	42	0.2545	0.3022	1.0000	8.98e-16	5yzg:H
30	6ah0:H	109	42	0.2545	0.3853	1.0000	8.98e-16	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
31	6ah0:H	109	37	0.2242	0.3394	1.0000	5.40e-13	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
32	8r09:2	98	39	0.2364	0.3980	1.0000	4.18e-14	8r0b:2, 8rm5:2
33	8r09:2	98	38	0.2303	0.3878	1.0000	1.50e-13	8r0b:2, 8rm5:2
34	8r08:2	97	39	0.2364	0.4021	1.0000	4.18e-14	8r0a:2
35	8r08:2	97	38	0.2303	0.3918	1.0000	1.50e-13	8r0a:2
36	8qxd:2	97	38	0.2303	0.3918	1.0000	1.50e-13
37	8qxd:2	97	38	0.2303	0.3918	1.0000	1.50e-13
38	6qx9:2	94	38	0.2303	0.4043	1.0000	1.50e-13
39	6qx9:2	94	34	0.2061	0.3617	1.0000	2.51e-11
40	8qo9:2	98	38	0.2303	0.3878	1.0000	1.50e-13	8qzs:2
41	8qo9:2	98	38	0.2303	0.3878	1.0000	1.50e-13	8qzs:2
42	8ro2:2	39	37	0.2242	0.9487	1.0000	5.40e-13
43	7abh:2	37	37	0.2242	1.0000	1.0000	5.40e-13
44	7q4o:2	35	35	0.2121	1.0000	1.0000	6.99e-12
45	7onb:H	32	32	0.1939	1.0000	1.0000	3.25e-10
46	7q4p:2	45	31	0.1879	0.6889	1.0000	1.17e-09

[Back]