Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
ccggaugguggaaucgguagacacaagggauaaucccucggcgugcugugcggguucaagucccgcuccgg

The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 2nqp:F 71 71 1.0000 1.0000 1.0000 2.44e-32
2 5on2:E 81 73 0.9859 0.8642 0.9589 6.84e-28
3 5onh:E 83 75 1.0000 0.8554 0.9467 8.84e-27
4 4aq7:E 77 71 0.9577 0.8831 0.9577 8.84e-27 5omw:E
5 4cqn:B 82 74 0.9859 0.8537 0.9459 3.18e-26 5onh:B
6 5omw:B 83 75 0.9859 0.8434 0.9333 4.11e-25
7 4as1:B 83 75 0.9859 0.8434 0.9333 4.11e-25
8 3zjv:B 85 77 1.0000 0.8353 0.9221 5.32e-24
9 3zgz:E 80 73 0.9577 0.8500 0.9315 5.32e-24
10 8pot:B 84 77 1.0000 0.8452 0.9221 5.32e-24
11 4aq7:B 79 73 0.9577 0.8608 0.9315 5.32e-24 4cqn:E, 5on3:B, 5on3:E
12 3zjt:B 83 75 0.9718 0.8313 0.9200 6.89e-23
13 3zgz:B 82 75 0.9718 0.8415 0.9200 6.89e-23
14 5on2:B 85 77 0.9859 0.8235 0.9091 2.48e-22
15 4ari:B 80 75 0.9577 0.8500 0.9067 1.15e-20 3zju:B
16 4arc:B 71 71 0.9014 0.9014 0.9014 1.93e-18

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218