auuuggucaauuugaauacagagaucagcaguuccccugcauaaggaugaaccguu
The query sequence (length=56) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5gap:W | 56 | 56 | 1.0000 | 1.0000 | 1.0000 | 3.90e-24 | |
2 | 5gan:W | 80 | 56 | 1.0000 | 0.7000 | 1.0000 | 3.90e-24 | |
3 | 5nrl:6 | 95 | 60 | 1.0000 | 0.5895 | 0.9333 | 1.41e-18 | |
4 | 5zwm:F | 99 | 59 | 0.9643 | 0.5455 | 0.9153 | 8.50e-16 | 5zwo:F |
5 | 3jcm:D | 45 | 41 | 0.7321 | 0.9111 | 1.0000 | 8.50e-16 | |
6 | 5y88:D | 101 | 63 | 1.0000 | 0.5545 | 0.8889 | 3.95e-14 | |
7 | 5mps:6 | 99 | 63 | 1.0000 | 0.5657 | 0.8889 | 3.95e-14 | 5mq0:6 |
8 | 5lj3:V | 97 | 63 | 1.0000 | 0.5773 | 0.8889 | 3.95e-14 | 5lj5:V |
9 | 7dco:F | 103 | 63 | 1.0000 | 0.5437 | 0.8889 | 3.95e-14 | 5gm6:E, 5gmk:E, 6j6g:E, 6j6h:E, 6j6n:E, 6j6q:E, 5wsg:E, 5ylz:D |
10 | 7b9v:6 | 102 | 63 | 1.0000 | 0.5490 | 0.8889 | 3.95e-14 | 6bk8:6, 6exn:6, 5lqw:6 |
11 | 5tf6:B | 71 | 59 | 0.9286 | 0.7324 | 0.8814 | 6.61e-12 |