aggcuuguagcucaggugguuagagcgcaccccugauaagggugaggucggugguucaaguccacucaggccuacca
The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5o2r:x | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 1.26e-35 | |
| 2 | 7b5k:x | 77 | 77 | 0.9870 | 0.9870 | 0.9870 | 5.85e-34 | |
| 3 | 8zyc:C | 73 | 73 | 0.9481 | 1.0000 | 1.0000 | 2.11e-33 | 8zyd:C |
| 4 | 1ffy:T | 75 | 71 | 0.9221 | 0.9467 | 1.0000 | 2.72e-32 | 1qu2:T, 1qu3:T |
| 5 | 8vu0:C | 76 | 77 | 0.9481 | 0.9605 | 0.9481 | 7.63e-28 | 8vu0:D |
| 6 | 5kcs:1x | 73 | 77 | 0.9481 | 1.0000 | 0.9481 | 7.63e-28 |
umich.edu