agauagucguggguucccuuucuggagggagagggaauuccacguugaccgggggaaccggccaggcccggaagggagca
accgugcccggcuauc
The query sequence (length=96) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 3ktw:C | 96 | 96 | 1.0000 | 1.0000 | 1.0000 | 4.58e-46 | |
| 2 | 3ktw:D | 95 | 95 | 0.9896 | 1.0000 | 1.0000 | 1.65e-45 | |
| 3 | 1qzw:B | 47 | 43 | 0.4479 | 0.9149 | 1.0000 | 1.33e-16 | 1qzw:D, 1qzw:F, 1qzw:H |
zhanggroup.org