tgcatccgtgagtcgagggtaataagttgcgagtgaaggttttgttttgacattcagtgctgtc
The query sequence (length=64) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7vwy:2 | 64 | 64 | 1.0000 | 1.0000 | 1.0000 | 9.35e-30 | 7vwz:2 |
| 2 | 7w5w:2 | 63 | 63 | 0.9844 | 1.0000 | 1.0000 | 3.36e-29 | |
| 3 | 7vwy:1 | 65 | 40 | 0.6250 | 0.6154 | 1.0000 | 2.05e-16 | 7vwz:1 |
| 4 | 7w5w:1 | 63 | 39 | 0.6094 | 0.6190 | 1.0000 | 7.38e-16 | |
| 5 | 7w5y:2 | 83 | 28 | 0.4375 | 0.3373 | 1.0000 | 9.61e-10 |
umich.edu