BioLiP

>dna
gtttttttctgtctcgtgcctggtgtcttgggtgtaatcccc

The query sequence (length=42) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7xti:T	85	42	1.0000	0.4941	1.0000	9.59e-18
2	7xtd:T	123	42	1.0000	0.3415	1.0000	9.59e-18
3	8jnd:J	153	42	1.0000	0.2745	1.0000	9.59e-18	8jne:J, 8xbt:J, 8xbu:J
4	8jnd:I	156	42	1.0000	0.2692	1.0000	9.59e-18	8jne:I, 8xbt:I, 8xbu:I
5	8jh3:T	159	42	1.0000	0.2642	1.0000	9.59e-18
6	6j4w:N	165	42	1.0000	0.2545	1.0000	9.59e-18
7	6j4w:T	171	42	1.0000	0.2456	1.0000	9.59e-18
8	6a5p:N	159	42	1.0000	0.2642	1.0000	9.59e-18
9	6a5p:T	168	42	1.0000	0.2500	1.0000	9.59e-18
10	6a5o:N	169	42	1.0000	0.2485	1.0000	9.59e-18
11	6a5o:T	178	42	1.0000	0.2360	1.0000	9.59e-18	8jh4:T
12	6a5l:1	42	42	1.0000	1.0000	1.0000	9.59e-18	6j4z:1
13	6a5l:0	42	42	1.0000	1.0000	1.0000	9.59e-18	6j4z:0
14	6j50:1	41	41	0.9762	1.0000	1.0000	3.45e-17
15	6j50:0	41	41	0.9762	1.0000	1.0000	3.45e-17
16	7xti:N	74	40	0.9524	0.5405	1.0000	1.24e-16
17	7xtd:N	112	40	0.9524	0.3571	1.0000	1.24e-16
18	6a5u:1	40	40	0.9524	1.0000	1.0000	1.24e-16
19	6a5u:0	40	40	0.9524	1.0000	1.0000	1.24e-16
20	7wbx:T	150	42	0.9762	0.2733	0.9762	4.46e-16
21	7wbv:T	159	39	0.9286	0.2453	1.0000	4.46e-16
22	7wbv:N	154	39	0.9286	0.2532	1.0000	4.46e-16
23	8he5:T	154	42	0.9762	0.2662	0.9762	4.46e-16	7wbw:T
24	6a5r:T	136	39	0.9286	0.2868	1.0000	4.46e-16
25	8he5:N	142	38	0.9048	0.2676	1.0000	1.60e-15
26	7xse:T	134	37	0.8810	0.2761	1.0000	5.77e-15
27	7xn7:T	53	37	0.8810	0.6981	1.0000	5.77e-15
28	7wbw:N	149	39	0.9048	0.2550	0.9744	2.08e-14
29	8jh2:0	40	36	0.8571	0.9000	1.0000	2.08e-14
30	6j51:1	36	36	0.8571	1.0000	1.0000	2.08e-14
31	6j51:0	36	36	0.8571	1.0000	1.0000	2.08e-14
32	7wbx:N	145	42	0.9286	0.2690	0.9286	3.47e-12
33	6ir9:T	128	31	0.7381	0.2422	1.0000	1.25e-11	6j4z:T, 6j50:T
34	6j4x:T	127	30	0.7143	0.2362	1.0000	4.49e-11	6j4y:T, 6j51:T, 8jh2:T
35	6a5l:T	126	29	0.6905	0.2302	1.0000	1.62e-10	6a5t:T, 6a5u:T
36	6inq:T	125	28	0.6667	0.2240	1.0000	5.81e-10

[Back]