cttcttcatcaactgagccgagcagacgtgcctacggaccatg
The query sequence (length=43) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8wb0:X | 43 | 43 | 1.0000 | 1.0000 | 1.0000 | 2.52e-18 | |
| 2 | 8waz:X | 43 | 42 | 0.9535 | 0.9535 | 0.9762 | 4.22e-16 | |
| 3 | 8wb0:Y | 54 | 42 | 0.9070 | 0.7222 | 0.9286 | 3.28e-12 | |
| 4 | 8waz:Y | 54 | 28 | 0.6512 | 0.5185 | 1.0000 | 5.49e-10 |
umich.edu