ctctgaatctcttcctcgtgtggtcaggacg
The query sequence (length=31) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8f3c:B | 31 | 31 | 1.0000 | 1.0000 | 1.0000 | 7.59e-12 | 8g00:B, 8g2w:B, 8g4w:B, 8g7e:B, 8g8z:B |
| 2 | 8g1s:B | 30 | 30 | 0.9677 | 1.0000 | 1.0000 | 2.73e-11 |
umich.edu