cactattttcggctactataaataaatgtttttttcgtaacccttcgtggacattt
The query sequence (length=56) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6f40:X | 56 | 56 | 1.0000 | 1.0000 | 1.0000 | 2.19e-25 | |
| 2 | 6f40:Y | 57 | 57 | 1.0000 | 0.9825 | 0.9825 | 1.02e-23 | |
| 3 | 6f41:X | 60 | 60 | 1.0000 | 0.9333 | 0.9333 | 7.93e-20 | |
| 4 | 6f44:Y | 44 | 40 | 0.6964 | 0.8864 | 0.9750 | 7.99e-15 | |
| 5 | 6f44:X | 44 | 37 | 0.6607 | 0.8409 | 1.0000 | 7.99e-15 | |
| 6 | 6f41:Y | 66 | 37 | 0.6607 | 0.5606 | 1.0000 | 7.99e-15 |
umich.edu